Difference between revisions of "Creosote"

Revision as of 09:41, 4 August 2011

Creosote genome sequencing and assembly notes:

• Sample obtained from front yard of 4951 W. McElroy Dr.
• Sequences obtained from one lane of Illumina HiSeq2000
• Fastq files delivered from UAGC
  • 82 files
    • lane3_NoIndex_L003_R1_041.fastq
    • lane3_NoIndex_L003_R2_041.fastq
  • Need to understand if these are paired-end reads
  • Need to get adapter sequences used in sequencing
  • Description of Fastq file format with notes on specific decoding of header names generated by various technologies: http://en.wikipedia.org/wiki/FASTQ_format
• Check quality with fastqc: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
  • Creosote First Run FastQC
• Sequences cleaned using trimReads by Haibao Tang: https://github.com/tanghaibao/trimReads/tree/
  • Ran with supplied adapter sequence file:

>Illumina_PE-1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_PE-2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>Illumina_PE-1rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>Illumina_PE-2rc
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG

• • Command-line run:

/home/elyons/bin/trimReads  -Q 33 -f /home/elyons/projects/genome/data/creosote/src/adapters.fasta ./lane3_NoIndex_L003_R1_033.fastq

• • Output of trimReads:

[0] Illumina_PE-1 found 54 times
[1] Illumina_PE-2 found 3 times
[2] Illumina_PE-1rc found 2850 times
[3] Illumina_PE-2rc found 12 times

A total of 92003 too short (trimmed length < 30) reads removed.
A total of 949092 trimmed reads are written to `./lane3_NoIndex_L003_R2_041.trimmed.fastq`.
Processed 1041095 sequences took 1557.84 seconds.

• • • Appears to not have the correct linkers as I would assume to see more removed