Creosote: Difference between revisions

From CoGepedia
Jump to navigation Jump to search
No edit summary
No edit summary
Line 24: Line 24:
**Command-line run:
**Command-line run:
  /home/elyons/bin/trimReads  -Q 33 -f /home/elyons/projects/genome/data/creosote/src/adapters.fasta ./lane3_NoIndex_L003_R1_033.fastq
  /home/elyons/bin/trimReads  -Q 33 -f /home/elyons/projects/genome/data/creosote/src/adapters.fasta ./lane3_NoIndex_L003_R1_033.fastq
**Output of trimReads:
[0] Illumina_PE-1 found 54 times
[1] Illumina_PE-2 found 3 times
[2] Illumina_PE-1rc found 2850 times
[3] Illumina_PE-2rc found 12 times
A total of 92003 too short (trimmed length < 30) reads removed.
A total of 949092 trimmed reads are written to `./lane3_NoIndex_L003_R2_041.trimmed.fastq`.
Processed 1041095 sequences took 1557.84 seconds.
***Appears to not have the correct linkers as I would assume to see more removed

Revision as of 16:41, 4 August 2011

Creosote genome sequencing and assembly notes:

>Illumina_PE-1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_PE-2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>Illumina_PE-1rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>Illumina_PE-2rc
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
    • Command-line run:
/home/elyons/bin/trimReads  -Q 33 -f /home/elyons/projects/genome/data/creosote/src/adapters.fasta ./lane3_NoIndex_L003_R1_033.fastq
    • Output of trimReads:
[0] Illumina_PE-1 found 54 times
[1] Illumina_PE-2 found 3 times
[2] Illumina_PE-1rc found 2850 times
[3] Illumina_PE-2rc found 12 times

A total of 92003 too short (trimmed length < 30) reads removed.
A total of 949092 trimmed reads are written to `./lane3_NoIndex_L003_R2_041.trimmed.fastq`.
Processed 1041095 sequences took 1557.84 seconds.
      • Appears to not have the correct linkers as I would assume to see more removed