JCVI notes: Difference between revisions
Jump to navigation
Jump to search
Created page with 'The fourth phrase: <pre>What I cannot build, I cannot understand</pre> Contains a direct repeat sequence. Let's see if this exists in the 4th watermark sequence. [[File:Screen s...' |
No edit summary |
||
| Line 6: | Line 6: | ||
<pre> ATACTGATATTTTAGTGCTGCCGTTGAATA</pre> | <pre> ATACTGATATTTTAGTGCTGCCGTTGAATA</pre> | ||
#Interesting. DRS is 30 characters "cannot" is 6 == looks like 5 nucleotide encoding scheme. However, there doesn't appear to be enough space between the two words. . . | #Interesting. DRS is 30 characters "cannot" is 6 == looks like 5 nucleotide encoding scheme. However, there doesn't appear to be enough space between the two words. . . | ||
# Almost: it is " I cannot " -- 10 characters! coding is 3 nucleotides. Where have I seen that before? | |||
Latest revision as of 03:50, 23 March 2012
The fourth phrase:
What I cannot build, I cannot understand
Contains a direct repeat sequence. Let's see if this exists in the 4th watermark sequence.
- Direct Repeat Sequence (DRS): 100% match, 30 characters
ATACTGATATTTTAGTGCTGCCGTTGAATA
- Interesting. DRS is 30 characters "cannot" is 6 == looks like 5 nucleotide encoding scheme. However, there doesn't appear to be enough space between the two words. . .
- Almost: it is " I cannot " -- 10 characters! coding is 3 nucleotides. Where have I seen that before?