GEvo Blastn Bug
From CoGepedia
Bug Description
When using blastn in GEvo, a large HSP appear in the middle of the region when the query sequence length is changed by 1 nucleotide.
Visualization
Difference between analyses is that addition of 1 nucleotide to the top panel of the top analysisReport of "disappearing" HSP in blast file
Top portion of blast report which contains the large HSP:
BLASTN 2.2.24+ Query= AT1G75520 Length=478 Subject= Bra008203 Length=17361 Score = 68.0 bits (35), Expect = 3e-14 Identities = 76/94 (80%), Gaps = 4/94 (4%) Strand=Plus/Plus Query 1 CTAGGTTTCGTGTTCCACTGATCAAAGATTTGAAAAAAAACATATACTTAGTAAACTTCA 60 |||||||| ||||||||||||||||||| || || ||||||| | |||||| | Sbjct 9943 CTAGGTTTTGTGTTCCACTGATCAAAGAGTT----AAGAACATATTTCAATAAAACTTTA 9998 Query 61 AGCAATTTTTATATTACCCAATTGAATTTCTCCA 94 | |||||||||| |||||| ||||||||||||| Sbjct 9999 AATAATTTTTATACTACCCAGTTGAATTTCTCCA 10032 Score = 54.5 bits (28), Expect = 3e-10 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand=Plus/Plus Query 442 TTGGCGTAGATGAATGTAAACGGATGGTAATATA 475 |||||||| |||||||||||||||| |||||||| Sbjct 10342 TTGGCGTATATGAATGTAAACGGATAGTAATATA 10375 Score = 50.7 bits (26), Expect = 4e-09 Identities = 77/95 (81%), Gaps = 5/95 (5%) Strand=Plus/Plus Query 129 ATATATATATACCCAACAACTGAGAAAAGATGGAAAAAGTTTAGTTAAAAACTGGTCCTG 188 ||||||||||| |||||| || |||||||||||| || || ||||||||| | | Sbjct 10072 ATATATATATAACCAACATCTCGGAAAAGATGGAACAAATT-AGTTAAAAAAA---CATT 10127 Query 189 GGCGGCTTTAAATTATATTTATGCACTTAAATTTA 223 ||||||||||||| ||||| ||| | ||||||||| Sbjct 10128 GGCGGCTTTAAATCATATTCATGTA-TTAAATTTA 10161 Score = 48.8 bits (25), Expect = 2e-08 Identities = 47/58 (81%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 316 GGTTTTTACTTAGATAATATCGTGTCATTCCATCTAGATTCAACCCCTGTCTACAATA 373 |||||| ||| |||| |||| || || | | ||||||||||||||| ||||||||| Sbjct 10207 GGTTTTCACTGAGATGATATTGTTCCAGTTCCACTAGATTCAACCCCTCTCTACAATA 10264 Score = 25.7 bits (13), Expect = 0.15 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 127 TAATATATATATA 139 ||||||||||||| Sbjct 7327 TAATATATATATA 7339