JCVI notes

From CoGepedia
Revision as of 22:41, 22 March 2012 by Elyons (talk | contribs) (Created page with 'The fourth phrase: <pre>What I cannot build, I cannot understand</pre> Contains a direct repeat sequence. Let's see if this exists in the 4th watermark sequence. [[File:Screen s...')
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

The fourth phrase: 

What I cannot build, I cannot understand

Contains a direct repeat sequence. Let's see if this exists in the 4th watermark sequence.

Direct repeats in watermark 4!
  1. Direct Repeat Sequence (DRS): 100% match, 30 characters
 ATACTGATATTTTAGTGCTGCCGTTGAATA
  1. Interesting. DRS is 30 characters "cannot" is 6 == looks like 5 nucleotide encoding scheme. However, there doesn't appear to be enough space between the two words. . .
Retrieved from "https://genomevolution.org/wiki/index.php?title=JCVI_notes&oldid=4535"