JCVI notes

From CoGepedia
Revision as of 03:50, 23 March 2012 by Elyons (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

The fourth phrase: 

What I cannot build, I cannot understand

Contains a direct repeat sequence. Let's see if this exists in the 4th watermark sequence.

Direct repeats in watermark 4!
  1. Direct Repeat Sequence (DRS): 100% match, 30 characters
 ATACTGATATTTTAGTGCTGCCGTTGAATA
  1. Interesting. DRS is 30 characters "cannot" is 6 == looks like 5 nucleotide encoding scheme. However, there doesn't appear to be enough space between the two words. . .
  2. Almost: it is " I cannot " -- 10 characters! coding is 3 nucleotides. Where have I seen that before?
Retrieved from "https://genomevolution.org/wiki/index.php?title=JCVI_notes&oldid=4597"