Difference between revisions of "Creosote"
From CoGepedia
(Created page with 'Creosote genome sequencing and assembly notes: *Sample obtained from front yard of 4951 W. McElroy Dr. *Sequences obtained from one lane of Illumina HiSeq2000 *Fastq files deliv...') |
|||
| Line 11: | Line 11: | ||
**Description of Fastq file format with notes on specific decoding of header names generated by various technologies: http://en.wikipedia.org/wiki/FASTQ_format | **Description of Fastq file format with notes on specific decoding of header names generated by various technologies: http://en.wikipedia.org/wiki/FASTQ_format | ||
*Check quality with fastqc: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ | *Check quality with fastqc: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ | ||
| + | **[[Creosote First Run FastQC]] | ||
*Sequences cleaned using trimReads by Haibao Tang: https://github.com/tanghaibao/trimReads/tree/ | *Sequences cleaned using trimReads by Haibao Tang: https://github.com/tanghaibao/trimReads/tree/ | ||
**Ran with supplied adapter sequence file: | **Ran with supplied adapter sequence file: | ||
Revision as of 10:34, 4 August 2011
Creosote genome sequencing and assembly notes:
- Sample obtained from front yard of 4951 W. McElroy Dr.
- Sequences obtained from one lane of Illumina HiSeq2000
- Fastq files delivered from UAGC
- 82 files
- lane3_NoIndex_L003_R1_041.fastq
- lane3_NoIndex_L003_R2_041.fastq
- Need to understand if these are paired-end reads
- Need to get adapter sequences used in sequencing
- Description of Fastq file format with notes on specific decoding of header names generated by various technologies: http://en.wikipedia.org/wiki/FASTQ_format
- 82 files
- Check quality with fastqc: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
- Sequences cleaned using trimReads by Haibao Tang: https://github.com/tanghaibao/trimReads/tree/
- Ran with supplied adapter sequence file:
>Illumina_PE-1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >Illumina_PE-2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT >Illumina_PE-1rc AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT >Illumina_PE-2rc AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
- Command-line run:
/home/elyons/bin/trimReads -Q 33 -f /home/elyons/projects/genome/data/creosote/src/adapters.fasta ./lane3_NoIndex_L003_R1_033.fastq
