Difference between revisions of "GEvo Blastn Bug"
From CoGepedia
(→Report of "disappearing" HSP in blast file) |
|||
Line 124: | Line 124: | ||
||||||||||||| | ||||||||||||| | ||
Sbjct 7327 TAATATATATATA 7339 | Sbjct 7327 TAATATATATATA 7339 | ||
+ | </pre> | ||
+ | Top portion of blast report which contains the large HSP :br> | ||
+ | <pre> | ||
+ | Lambda K H | ||
+ | 1.33 0.621 1.12 | ||
+ | |||
+ | Gapped | ||
+ | Lambda K H | ||
+ | 1.33 0.621 1.12 | ||
+ | |||
+ | Effective search space used: 8066820 | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | Matrix: blastn matrix 1 -2 | ||
+ | Gap Penalties: Existence: 5, Extension: 2 | ||
+ | </pre> | ||
+ | |||
+ | Top portion of blast report which DOES NOT contains the large HSP :<br> | ||
+ | <pre> | ||
+ | Lambda K H | ||
+ | 1.33 0.621 1.12 | ||
+ | |||
+ | Gapped | ||
+ | Lambda K H | ||
+ | 1.33 0.621 1.12 | ||
+ | |||
+ | Effective search space used: 8084168 | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | Matrix: blastn matrix 1 -2 | ||
+ | Gap Penalties: Existence: 5, Extension: 2 | ||
</pre> | </pre> | ||
Revision as of 06:08, 11 February 2012
Contents
Bug Description
When using blastn in GEvo, a large HSP appear in the middle of the region when the query sequence length is changed by 1 nucleotide.
Visualization
Difference between analyses is that addition of 1 nucleotide to the top panel of the top analysis
Report of "disappearing" HSP in blast file
Top portion of blast report which contains the large HSP (problem HSP starts at "Query 129"):
BLASTN 2.2.24+ Query= AT1G75520 Length=478 Subject= Bra008203 Length=17361 Score = 68.0 bits (35), Expect = 3e-14 Identities = 76/94 (80%), Gaps = 4/94 (4%) Strand=Plus/Plus Query 1 CTAGGTTTCGTGTTCCACTGATCAAAGATTTGAAAAAAAACATATACTTAGTAAACTTCA 60 |||||||| ||||||||||||||||||| || || ||||||| | |||||| | Sbjct 9943 CTAGGTTTTGTGTTCCACTGATCAAAGAGTT----AAGAACATATTTCAATAAAACTTTA 9998 Query 61 AGCAATTTTTATATTACCCAATTGAATTTCTCCA 94 | |||||||||| |||||| ||||||||||||| Sbjct 9999 AATAATTTTTATACTACCCAGTTGAATTTCTCCA 10032 Score = 54.5 bits (28), Expect = 3e-10 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand=Plus/Plus Query 442 TTGGCGTAGATGAATGTAAACGGATGGTAATATA 475 |||||||| |||||||||||||||| |||||||| Sbjct 10342 TTGGCGTATATGAATGTAAACGGATAGTAATATA 10375 Score = 50.7 bits (26), Expect = 4e-09 Identities = 77/95 (81%), Gaps = 5/95 (5%) Strand=Plus/Plus Query 129 ATATATATATACCCAACAACTGAGAAAAGATGGAAAAAGTTTAGTTAAAAACTGGTCCTG 188 ||||||||||| |||||| || |||||||||||| || || ||||||||| | | Sbjct 10072 ATATATATATAACCAACATCTCGGAAAAGATGGAACAAATT-AGTTAAAAAAA---CATT 10127 Query 189 GGCGGCTTTAAATTATATTTATGCACTTAAATTTA 223 ||||||||||||| ||||| ||| | ||||||||| Sbjct 10128 GGCGGCTTTAAATCATATTCATGTA-TTAAATTTA 10161 Score = 48.8 bits (25), Expect = 2e-08 Identities = 47/58 (81%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 316 GGTTTTTACTTAGATAATATCGTGTCATTCCATCTAGATTCAACCCCTGTCTACAATA 373 |||||| ||| |||| |||| || || | | ||||||||||||||| ||||||||| Sbjct 10207 GGTTTTCACTGAGATGATATTGTTCCAGTTCCACTAGATTCAACCCCTCTCTACAATA 10264 Score = 25.7 bits (13), Expect = 0.15 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 127 TAATATATATATA 139 ||||||||||||| Sbjct 7327 TAATATATATATA 7339
Top portion of blast report which DOES NOT contains the large HSP :
BLASTN 2.2.24+ Query= AT1G75520 Length=479 Subject= Bra008203 Length=17361 Score = 69.9 bits (36), Expect = 7e-15 Identities = 77/95 (81%), Gaps = 4/95 (4%) Strand=Plus/Plus Query 1 ACTAGGTTTCGTGTTCCACTGATCAAAGATTTGAAAAAAAACATATACTTAGTAAACTTC 60 ||||||||| ||||||||||||||||||| || || ||||||| | |||||| Sbjct 9942 ACTAGGTTTTGTGTTCCACTGATCAAAGAGTT----AAGAACATATTTCAATAAAACTTT 9997 Query 61 AAGCAATTTTTATATTACCCAATTGAATTTCTCCA 95 || |||||||||| |||||| ||||||||||||| Sbjct 9998 AAATAATTTTTATACTACCCAGTTGAATTTCTCCA 10032 Score = 54.5 bits (28), Expect = 3e-10 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand=Plus/Plus Query 443 TTGGCGTAGATGAATGTAAACGGATGGTAATATA 476 |||||||| |||||||||||||||| |||||||| Sbjct 10342 TTGGCGTATATGAATGTAAACGGATAGTAATATA 10375 Score = 48.8 bits (25), Expect = 2e-08 Identities = 47/58 (81%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 317 GGTTTTTACTTAGATAATATCGTGTCATTCCATCTAGATTCAACCCCTGTCTACAATA 374 |||||| ||| |||| |||| || || | | ||||||||||||||| ||||||||| Sbjct 10207 GGTTTTCACTGAGATGATATTGTTCCAGTTCCACTAGATTCAACCCCTCTCTACAATA 10264 Score = 25.7 bits (13), Expect = 0.15 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 128 TAATATATATATA 140 ||||||||||||| Sbjct 7327 TAATATATATATA 7339
Top portion of blast report which contains the large HSP :br>
Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.621 1.12 Effective search space used: 8066820 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 5, Extension: 2
Top portion of blast report which DOES NOT contains the large HSP :
Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.33 0.621 1.12 Effective search space used: 8084168 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 5, Extension: 2
Blast Commands
/usr/local/bin/legacy_blast.pl bl2seq -p blastn -o /opt/apache/CoGe/tmp/GEvo/52376346_1-2.bl2seq -i /opt/apache/CoGe/tmp/GEvo/f34524790ds39598r1c1u-2233d777g2dsg3.faa -j /opt/apache/CoGe/tmp/GEvo/f103007203ds48732r1cA02u8000d8000g1dsg12468.faa -W 7 -G 5 -E 2 -q -2 -r 1 -e 30 -F F
/usr/local/bin/legacy_blast.pl bl2seq -p blastn -o /opt/apache/CoGe/tmp/GEvo/22224470_1-2.bl2seq -i /opt/apache/CoGe/tmp/GEvo/f34524790ds39598r1c1u-2232d777g2dsg3.faa -j /opt/apache/CoGe/tmp/GEvo/f103007203ds48732r1cA02u8000d8000g1dsg12468.faa -W 7 -G 5 -E 2 -q -2 -r 1 -e 30 -F F